===VirGA HSV-KOSsyn Report Summary===
Date generated: Mon May 5 16:41:16 EDT 2014

Genome name	HSV-KOSsyn.fa
Genome annotation	HSV-KOSsyn.gff
Genome length	135683 bp
Genome name (with TRL/TRS)	full-length_HSV-KOSsyn.fa
Genome annotation (with TRL/TRS)	full-length_HSV-KOSsyn.gff
Genome length (with TRL/TRS)	150970 bp
Number of bases with >=100 depth support	133371 (98.29%)
Number of gaps	3
Number of Ns	721
Complete protein annotations	71
Incomplete protein annotations	3
Reference name	HSV-17_trimmed.fa
Reference annotation	HSV-17_trimmed.gff

Coverage plot demonstrating read depth across the new genome
All annotations from the .gff file have been added as separate tracks, as well as low coverage and gap regions. (click to enlarge)

The following proteins were correctly assembled and annotated from the HSV-KOSsyn genome
(Click on the protein names to see their alignment to the reference genome)

gene_RL1: Gene\|ORF\|AA	No errors	gene_RL2: Gene\|ORF\|AA	No errors	gene_UL1: Gene\|ORF\|AA	No errors
gene_UL2: Gene\|ORF\|AA	No errors	gene_UL3: Gene\|ORF\|AA	No errors	gene_UL4: Gene\|ORF\|AA	No errors
gene_UL5: Gene\|ORF\|AA	No errors	gene_UL6: Gene\|ORF\|AA	No errors	gene_UL7: Gene\|ORF\|AA	No errors
gene_UL8: Gene\|ORF\|AA	No errors	gene_UL9: Gene\|ORF\|AA	No errors	gene_UL10: Gene\|ORF\|AA	No errors
gene_UL11: Gene\|ORF\|AA	No errors	gene_UL12: Gene\|ORF\|AA	No errors	gene_UL13: Gene\|ORF\|AA	No errors
gene_UL14: Gene\|ORF\|AA	No errors	gene_UL15: Gene\|ORF\|AA	No errors	gene_UL16: Gene\|ORF\|AA	No errors
gene_UL17: Gene\|ORF\|AA	No errors	gene_UL18: Gene\|ORF\|AA	No errors	gene_UL19: Gene\|ORF\|AA	No errors
gene_UL20: Gene\|ORF\|AA	No errors	gene_UL21: Gene\|ORF\|AA	No errors	gene_UL22: Gene\|ORF\|AA	No errors
gene_UL23: Gene\|ORF\|AA	No errors	gene_UL24: Gene\|ORF\|AA	No errors	gene_UL25: Gene\|ORF\|AA	No errors
gene_UL26: Gene\|ORF\|AA	No errors	gene_UL26.5: Gene\|ORF\|AA	No errors	gene_UL27: Gene\|ORF\|AA	No errors
gene_UL28: Gene\|ORF\|AA	No errors	gene_UL29: Gene\|ORF\|AA	No errors	gene_UL30: Gene\|ORF\|AA	No errors
gene_UL31: Gene\|ORF\|AA	No errors	gene_UL32: Gene\|ORF\|AA	No errors	gene_UL33: Gene\|ORF\|AA	No errors
gene_UL34: Gene\|ORF\|AA	No errors	gene_UL35: Gene\|ORF\|AA	No errors	gene_UL36: Gene\|ORF\|AA	No errors
gene_UL37: Gene\|ORF\|AA	No errors	gene_UL38: Gene\|ORF\|AA	No errors	gene_UL39: Gene\|ORF\|AA	No errors
gene_UL40: Gene\|ORF\|AA	No errors	gene_UL41: Gene\|ORF\|AA	No errors	gene_UL42: Gene\|ORF\|AA	No errors
gene_UL43: Gene\|ORF\|AA	No errors	gene_UL44: Gene\|ORF\|AA	No errors	gene_UL45: Gene\|ORF\|AA	No errors
gene_UL46: Gene\|ORF\|AA	No errors	gene_UL47: Gene\|ORF\|AA	No errors	gene_UL48: Gene\|ORF\|AA	No errors
gene_UL49: Gene\|ORF\|AA	No errors	gene_UL49A: Gene\|ORF\|AA	No errors	gene_UL50: Gene\|ORF\|AA	No errors
gene_UL51: Gene\|ORF\|AA	No errors	gene_UL52: Gene\|ORF\|AA	No errors	gene_UL53: Gene\|ORF\|AA	No errors
gene_UL54: Gene\|ORF\|AA	No errors	gene_UL55: Gene\|ORF\|AA	No errors	gene_UL56: Gene\|ORF\|AA	No errors
gene_US1: Gene\|ORF\|AA	No errors	gene_US2: Gene\|ORF\|AA	No errors	gene_US3: Gene\|ORF\|AA	No errors
gene_US4: Gene\|ORF\|AA	No errors	gene_US5: Gene\|ORF\|AA	No errors	gene_US6: Gene\|ORF\|AA	No errors
gene_US7: Gene\|ORF\|AA	No errors	gene_US8: Gene\|ORF\|AA	No errors	gene_US10: Gene\|ORF\|AA	No errors
gene_US11: Gene\|ORF\|AA	No errors	gene_US12: Gene\|ORF\|AA	No errors

Proteins requiring review due to potential assembly defects or substantial biological variation:

gene_RS1: Gene\|ORF\|AA	(Gaps found)
gene_US8A: Gene\|ORF\|AA	(Stop codon missing)
gene_US9: Gene\|ORF\|AA	(Sample is more than 10% shorter than the reference) (Early stop codon found)

The following genome features are non-protein coding and were aligned to the reference for visual comparison
(Click the feature names to see their alignment to the reference. Only features <= 5kb were aligned.)

gene_LAT: None	gene_US12_start_in_IRS: DNA	hsv1-mir-H1: DNA
hsv1-mir-H2: DNA	hsv1-mir-H3: DNA	hsv1-mir-H4: DNA
hsv1-mir-H5: DNA	hsv1-mir-H6: DNA	hsv1-mir-H7: DNA
hsv1-mir-H8: DNA	hsv1-mir-H11: DNA	hsv1-mir-H12: DNA
hsv1-mir-H13: DNA	hsv1-mir-H14: DNA	hsv1-mir-H16: DNA
hsv1-mir-H18: DNA	hsv1-mir-H26: DNA	hsv1-mir-H27: DNA
oriL: DNA	oriS: DNA	UL: None
US: None	IRL: None	IRS: None
a_prime: DNA

===VirGA Detailed Report===

VirGA steps completed:

   - STEP_1:Preprocessing
   - STEP_2:Multi_SSAKE_Assembly
   - STEP_3:Annotation
   - STEP_4:Assembly_Assessment

STEP_1:Preprocessing Output

Raw reads within sample1 (HSV-KOSsyn_1.fastq ): 22860146
Raw reads within sample2 (HSV-KOSsyn_2.fastq ): 22860146

Procedure: 'before_stats'
Purpose: Create histograms of raw read quality and other metrics

FastQC Results for HSV-KOSsyn_1.fastq : FastQC-Report
FastQC Results for HSV-KOSsyn_2.fastq : FastQC-Report

Procedure: 'fastx_clip_adapters'
Purpose: Clip leftover adapters from the raw sequencing reads

Clipping Adapter: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Min. Length: 30
Input: 22860146 reads.
Output: 21860165 reads.
discarded 892615 too-short reads.
discarded 49631 adapter-only reads.
discarded 57735 N reads.
Clipping Adapter: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Min. Length: 30
Input: 22860146 reads.
Output: 21761541 reads.
discarded 878536 too-short reads.
discarded 48072 adapter-only reads.
discarded 171997 N reads.

Procedure: 'fastx_trim_qual'
Purpose: Trim low quality bases from sequencing reads

TrimmomaticSE: Started with arguments: -phred33 /gpfs/home/jus57/biostar/1--Raw_Reads_Per_Genome/HSV-KOSsyn/VirGA_Pipeline_Directory/STEP_1--Preprocessing/clipped_reads/clip_HSV-KOSsyn_1.fastq /gpfs/home/jus57/biostar/1--Raw_Reads_Per_Genome/HSV-KOSsyn/VirGA_Pipeline_Directory/STEP_1--Preprocessing/trimmed_reads/trim_clip_HSV-KOSsyn_1.fastq SLIDINGWINDOW:15:30 MINLEN:30
Automatically using 16 threads
Input Reads: 21860165 Surviving: 20401833 (93.33%) Dropped: 1458332 (6.67%)
TrimmomaticSE: Completed successfully
TrimmomaticSE: Started with arguments: -phred33 /gpfs/home/jus57/biostar/1--Raw_Reads_Per_Genome/HSV-KOSsyn/VirGA_Pipeline_Directory/STEP_1--Preprocessing/clipped_reads/clip_HSV-KOSsyn_2.fastq /gpfs/home/jus57/biostar/1--Raw_Reads_Per_Genome/HSV-KOSsyn/VirGA_Pipeline_Directory/STEP_1--Preprocessing/trimmed_reads/trim_clip_HSV-KOSsyn_2.fastq SLIDINGWINDOW:15:30 MINLEN:30
Automatically using 16 threads
Input Reads: 21761541 Surviving: 19466503 (89.45%) Dropped: 2295038 (10.55%)
TrimmomaticSE: Completed successfully

Procedure: 'fastx_remove_artifacts'
Purpose: Remove sequencing artifacts from the read pool

Input: 20401833 reads.
Output: 20401358 reads.
discarded 475 (0%) artifact reads.
Input: 19466503 reads.
Output: 19466110 reads.
discarded 393 (0%) artifact reads.

Procedure: 'filter_contaminants'
Purpose: Remove reads that are derived from a contaminating source, e.g. host cells

20401358 reads; of these:
20401358 (100.00%) were unpaired; of these:
20266145 (99.34%) aligned 0 times
100064 (0.49%) aligned exactly 1 time
35149 (0.17%) aligned >1 times
0.66% overall alignment rate
19466110 reads; of these:
19466110 (100.00%) were unpaired; of these:
19333144 (99.32%) aligned 0 times
98691 (0.51%) aligned exactly 1 time
34275 (0.18%) aligned >1 times
0.68% overall alignment rate

Removed 135213 contaminate reads

Removed 132966 contaminate reads

Procedure: 'only_save_paired'
Purpose: Only save reads that are properly paired

R1 read count: 20266145
R2 read count: 19333144
Total read count: 39599289
Singletons: 3898177
Properly paired reads: 17850556

Procedure: 'after_stats'
Purpose: Create histograms of raw read quality and other metrics

FastQC Results for HSV-KOSsyn_1.fastq : FastQC-Report
FastQC Results for HSV-KOSsyn_2.fastq : FastQC-Report

STEP_2:Multi_SSAKE_Assembly

Procedure: 'multi_ssake'
Purpose: Iteratively run SSAKE de bruijn graph generations to assemble rough contigs

Total # of contigs: 5442
Average contig length: 439
Longest contig: 34782
Shortest contig: 63
N20: 10970
N50: 934
N80: 198
Number of contigs >= N50: 248
Total # of bases: 2391750

Procedure: 'use_celera'
Purpose: Use celera to assemble rough contigs into high quality contigs

Total # of contigs: 32
Average contig length: 4735
Longest contig: 127984
Shortest contig: 101
N20: 127984
N50: 127984
N80: 127984
Number of contigs >= N50: 1
Total # of bases: 151530

STEP_3:Annotation

Procedure: 'mugsy_maf-net_compare_genome'
Purpose: Align quality contigs with reference to produce linearized genome assembly

Assembled_genome contains 918 Ns
Assembled_genome contains 135798 total bases

Procedure: 'use_gapfiller'
Purpose: Fill gaps in the assembled genome using paired-end read data

Closed 2 out of 3 gaps
Closed 261 out of 974 nucleotides
Closed 0 out of 1 gaps
Closed 0 out of 713 nucleotides

Assembled_genome after GapFiller contains 717 Ns
Assembled_genome after GapFiller contains 135680 total bases

STEP_4:Assembly_Assessment

Procedure: 'Bowtie2_map'
Purpose: Align reads back to the new genome assembly using Bowtie2

17850556 reads; of these:
17850556 (100.00%) were paired; of these:
103362 (0.58%) aligned concordantly 0 times
17710588 (99.22%) aligned concordantly exactly 1 time
36606 (0.21%) aligned concordantly >1 times
----
103362 pairs aligned concordantly 0 times; of these:
37330 (36.12%) aligned discordantly 1 time
----
66032 pairs aligned 0 times concordantly or discordantly; of these:
132064 mates make up the pairs; of these:
95783 (72.53%) aligned 0 times
35502 (26.88%) aligned exactly 1 time
779 (0.59%) aligned >1 times
99.73% overall alignment rate
[samopen] SAM header is present: 1 sequences.
[bam_sort_core] merging from 15 files...

Procedure: 'call_variants'
Purpose: Find the variants (INDELS/SNPs) in the newly assembled genomes

SAMTools indels called: 0
SAMTools SNPs called: 2
Freebayes indels called: 34
Freebayes SNPs called: 51

Procedure: 'filter_false_SNPs'
Purpose: Replace misassembled bases from the genome that are found as false SNPs

Number of false SNPs corrected in the genome: 26

Procedure: 'create_low_coverage_gff'
Purpose: Generate a .gff file that reports areas of the genome with coverage lower than a threshold
low_coverage.gff

Threshold for determining low coverage: 15

Procedure: 'create_no_coverage_gff'
Purpose: Generate a .gff file that reports areas of the genome that contain gaps
no_coverage.gff

VirGA steps completed:

- STEP_1:Preprocessing - STEP_2:Multi_SSAKE_Assembly - STEP_3:Annotation - STEP_4:Assembly_Assessment

STEP_1:Preprocessing Output

STEP_2:Multi_SSAKE_Assembly

STEP_3:Annotation

STEP_4:Assembly_Assessment

===End Report===

- STEP_1:Preprocessing
- STEP_2:Multi_SSAKE_Assembly
- STEP_3:Annotation
- STEP_4:Assembly_Assessment